My DNA strand!

TTACATTTACCTCTAAAAATTGTCTGTTAGCTTGATC

1.Jean-Baptiste Lamarck’s contributions to science were mostly positive. 

1. Lamarck’s life was very sad. He was in the military and became an officer. Then he accidentally injured himself and became a bank teller in France. He then was the assistant in the Royal Botanical Garden because of his recently found love for medicine and botany. Right after the French revolution he was appointed professor of insects and worms at the Natural History Museum (not considered a prestigious job by the fellow professors at the museum). He made the best of it and really studied invertebrates, a term he came up with. He wrote a series of books on invertebrate zoology and paleontology which contained most of his theories on evolution. He also did great work with new classifications within the invertebrate family. Lamarck’s most important contributions to science were his evolutionary theories. They really paralleled Darwin's ideas. Though some of his theories were dead wrong, his result is the same as Darwin's. Lamarck thought that if animals used a specific body part a lot it would get bigger and or longer. Also if it wasn't used much it would shrink and or go away completely. He called this the first law. His second law was that these growing and shrinking organs were heritable. He also argued that the earth was extremely old and even mentioned natural selection sometimes but never really saw it as a valuable idea. Besides being wrong about his two laws, he went askew in other areas. He thought that really simple organisms like protists spontaneously generate. He also believed that if a species disappeared, it wasn't because it was extinct. It was because they evolved into a different species. I think Lamarck really helped science by opening the door for new ways of thought for scientists as daring as him, like Darwin.  http://www.ucmp.berkeley.edu/history/lamarck.html
2. Lamarck doesn’t really connect with any of the bullet points. Darwin did know that natural selection was the key, not the whole growing and shrinking body parts idea that Lamarck came up with. So Lamarck only helped Darwin by helping ease people into the idea of evolution. He also partly inspired Darwin to really figure out all this evolution stuff.
3. I think Darwin could have developed his theory without Lamarck. I think Darwin had the brains and the research in his notes from the Galapagos. I think he just didn’t have the guts to stand up to everyone. I think Lamarck helped Darwin with guts. Without Lamarck, I think it would just have taken Darwin longer to publish his book.
4. The influence of the church really slowed Darwin down. I also think it helped Darwin realize if he was going to publish a book as radical as he did, it really had to be good. I think because his peers were all so into the views of the church that he wanted the book to be really good and knock everyone's socks off when it came out. Otherwise no one would take him seriously. I think it was good there was little support for him because he had more to prove with his book.