Brown Figs and Blue Plums

Thursday, September 5, 2013

My DNA strand!

TTACATTTACCTCTAAAAATTGTCTGTTAGCTTGATC

Posted by Josh Winklhofer at 6:19 PM 3 comments:

Email This BlogThis!Share to X Share to Facebook Share to Pinterest

Newer Posts Older Posts Home

Subscribe to: Comments (Atom)

Blog Archive

▼ 2013 (2)
- ▼ September (1)
  - My DNA strand!
- ► August (1)

About Me

Josh Winklhofer: Blogging is fun :)

View my complete profile

Travel theme. Powered by Blogger.